RNA STRAND v2.0 - The RNA secondary STRucture and statistical ANalysis Database

General features for molecule PDB_00201 (click to expand/contract all tables) Format: CT RNAML Bpseq Dot-parentheses FASTA Molecule ID [?]: PDB_00201 Molecule name [?]: NMR STRUCUTRE OF 5'-R(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : AN RNA HAIRPIN CONTAINING THE IN VITRO SELECT Source [?]: RCSB Protein Data Bank Source ID [?]: 1QWB Reference [?]: L.D.FINGER,L.TRANTIREK,C.JOHANSSON,J.FEIGON. SOLUTION STRUCTURES OF STEM-LOOP RNAS THAT BIND THE TWO N-TERMINAL RNA-BINDING DOMAINS OF NUCLEOLIN. NUCLEIC ACIDS RES. V. 31 6461 2003 ASTM NARHAD UK ISSN 0305-1048 Type [?]: Synthetic RNA [?]     PS figure     PDF figure Figure from original source Organism [?]: SYNTHETIC Validated by NMR or X-Ray [?]: Yes Method for secondary structure determination [?]: NMR; ran through RNAview Number of molecules [?]: 1 Length [?]: 26 Fragments used [?]: No Duplicated sequence [?]: No other molecule in the database has the same sequence Number of domains [?]: 1 Number of unpaired bases [?]: 6 Number of paired bases [?]: 20

Click on any header below for additional features.

Stem features Number of stems [?]: 2 Number of base pairs in stems [?]: 10 Maximum length of a stem [?]: 8 Average length of a stem [?]: 5 Minimum length of a stem [?]: 2 Maximum estimated free energy [?]: 0 Average estimated free energy [?]: -6.1 Minimum estimated free energy [?]: -12.2

Hairpin loop features Number of hairpin loops [?]: 1 Maximum number of free bases in hairpin loops [?]: 5 Average number of free bases in hairpin loops [?]: 5 Minimum number of free bases in hairpin loop [?]: 5

Bulge loop features Number of bulge loops [?]: 1 Maximum number of free bases in bulge loops [?]: 1 Average number of free bases in bulge loops [?]: 0.5 Minimum number of free bases in bulge loop [?]: 0

Internal loop features

Multi-loop features

Non-canonical base pairs features Total number of non-canonical base pairs [?]: 3 Total number of AA non-canonical base pairs: 2 Total number of AG non-canonical base pairs: 1

Pseudoknot features

For questions, comments, suggestions and bug reports, please contact:

Copyright © 2004-2008 BETA LAB - University of British Columbia