RNA STRAND v2.0 - The RNA secondary STRucture and statistical ANalysis Database

General features for molecule PDB_00203 (click to expand/contract all tables) Format: CT RNAML Bpseq Dot-parentheses FASTA Molecule ID [?]: PDB_00203 Molecule name [?]: NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRE Source [?]: RCSB Protein Data Bank Source ID [?]: 1R7W Reference [?]: Z.DU,N.B.ULYANOV,J.YU,R.ANDINO,T.L.JAMES. NMR STRUCTURES OF LOOP B RNAS FROM THE STEM-LOOP IV DOMAIN OF THE ENTEROVIRUS INTERNAL RIBOSOME ENTRY SITE: A SINGLE C TO U SUBSTITUTION DRASTICALLY CHANGES THE SHAPE AND FLEXIBILITY OF RNA(,).. BIOCHEMISTRY V. 43 5757 2004 ASTM BICHAW US ISSN 0006-2960 Type [?]: Viral & Phage RNA [?]     PS figure     PDF figure Figure from original source Organism [?]: N/A Validated by NMR or X-Ray [?]: Yes Method for secondary structure determination [?]: NMR; ran through RNAview Number of molecules [?]: 1 Length [?]: 34 Fragments used [?]: Yes Duplicated sequence [?]: No other molecule in the database has the same sequence Number of domains [?]: 1 Number of unpaired bases [?]: 8 Number of paired bases [?]: 26

Click on any header below for additional features.

Stem features Number of stems [?]: 2 Number of base pairs in stems [?]: 13 Maximum length of a stem [?]: 7 Average length of a stem [?]: 6.5 Minimum length of a stem [?]: 6 Maximum estimated free energy [?]: -10 Average estimated free energy [?]: -12.85 Minimum estimated free energy [?]: -15.7

Hairpin loop features Number of hairpin loops [?]: 1 Maximum number of free bases in hairpin loops [?]: 2 Average number of free bases in hairpin loops [?]: 2 Minimum number of free bases in hairpin loop [?]: 2

Bulge loop features Number of bulge loops [?]: 1 Maximum number of free bases in bulge loops [?]: 6 Average number of free bases in bulge loops [?]: 3 Minimum number of free bases in bulge loop [?]: 0

Internal loop features

Multi-loop features

Non-canonical base pairs features Total number of non-canonical base pairs [?]: 1 Total number of AG non-canonical base pairs: 1

Pseudoknot features

For questions, comments, suggestions and bug reports, please contact:

Copyright © 2004-2008 BETA LAB - University of British Columbia